lenti sgrna ms2 zeo backbone (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc lenti sgrna ms2 zeo backbone
Lenti Sgrna Ms2 Zeo Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 148 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenti+sgrna+ms2+zeo+backbone/lenti+sgRNA(MS2)_zeo+backbone+(Plasmid+%2361427)/pm41271724-368-14-17
Average 95 stars, based on 148 article reviews

lenti sgrna ms2 zeo backbone - by Bioz Stars, 2026-10

95/100 stars

Images

Plasmid Preparation:

Article Title: Epigenetic Regulation of Host Membrane Protein-encoding Genes Facilitates African Swine Fever Virus Infection
Article Snippet: The pcDNA-dCas9-p300-Core vector (Addgene, plasmid #61357) and MluI/BstXI-digested pHRTRE3G- KRAB-dCas9- P2A-mCherry vector were used to construct an inducible dCas9-p300 expression vector. .. To obtain the enCRISPRa sgRNA vector, we ampli ed the MCP-VP64-IRESmCherry region of the pJZC34 vector (Addgene, plasmid #62331) and cloned this region into the BsrGI/EcoRI-digested lenti-sgRNA (MS2)-zeo backbone (Addgene, plasmid #61427). ..

Clone Assay:

Article Title: Gain-of-function genetic screens in human cells identify SLC transporters overcoming environmental nutrient restrictions
Article Snippet: SgRNA were cloned into lenti sgRNA(MS2)_zeo backbone (Addgene: 61427). .. Cloned oligonucleotides, named accordingly to the SLC SAM library ID, were as follows: SLC7A3 (sg3 F caccgGGCTTTGCAAAAGGATTGCG, R aaacCGCAATCCTTTTGCAAAGCCc; sg4 F caccgTGAGGATGGGACGCAGTCTC, R aaacGAGACTGCGTCCCATCCTCAc; sg5 F caccgTAGCGAGGAGGATTGGGGGT, R aaacACCCCCAATCCTCCTCGCTAc); SLC7A5 (sg3 F caccgCCCGCCCCCTCGGCCCAGCT, R aaacAGCTGGGCCGAGGGGGCGGGc; sg4 F caccgGAGGGACGGGGCCGGGCCAC, R aaacGTGGCCCGGCCCCGTCCCTCc; sg5 F caccgGTGCGTCGTCCGGCCCAGCC, R aaacGGCTGGGCCGGACGACGCACc), SLC1A2 (sg3 F caccgAGATCCTGGGCTCCTGCCAC, R aaacGTGGCAGGAGCCCAGGATCTc; sg4 F caccgGGCAGAGGAGGGACCGCGAC, R aaacGTCGCGGTCCCTCCTCTGCCc; sg5 F caccgAAAGGAGTTGCCCGAGGCGG, R aaacCCGCCTCGGGCAACTCCTTTc), sgSLC1A3 (sg1 F caccgCACCCTCGTCTTCCCTGAAA, R aaacTTTCAGGGAAGACGAGGGTGc; sg2 F caccgAGGAAACATGCAATAATGTG, R aaacCACATTATTGCATGTTTCCTc; sg5 F caccgCTCGTAACAGTTGTACAACC, R aaacGGTTGTACAACTGTTACGAGc). sgRen targeting Renilla luciferase cDNA was used as negative-control sgRNA (GGTATAATACACCGCGCTAC) ( ) and cloned into lenti sgRNA(MS2)-zeo backbone (Addgene: 61427) or lenti sgRNA(MS2)-zeo-IRES-eGFP backbone. .. Codon-optimized cDNAs for human SLC7A3 , SLC1A2 , and SLC1A3 were obtained from Genscript and cloned in pTO vectors with or without a N- or C-terminal Strep-HA tag.

Article Title: A modular strategy for extracellular vesicle-mediated CRISPR-Cas9 delivery through aptamer-based loading and UV-activated cargo release.
Article Snippet: In short, complementary synthesized oligonucleotides (Integrated DNA technologies) were annealed and ligated into a lentiGuide-Puro plasmid after BsmBI digestion (New England Biolabs). .. For the expression of MS2-sgRNAs, complementary synthesized oligonucleotides were annealed and cloned into the lenti sgRNA(MS2)Zeo backbone (Addgene #61427)30 after BsmBI digestion. .. For unmodified sgRNA expression, targeting sequences were cloned into a lentiGuide-Puro plasmid (Addgene #52963)65 as previously described31.

Article Title: A modular strategy for extracellular vesicle-mediated CRISPR-Cas9 delivery through aptamer-based loading and UV-activated cargo release
Article Snippet: In short, complementary synthesized oligonucleotides (Integrated DNA technologies) were annealed and ligated into a lentiGuide- Puro plasmid after BsmBI digestion (New England Biolabs). .. For the expression of MS2-sgRNAs, complementary synthesized oligonucleotides were annealed and cloned into the lenti sgRNA(MS2)-Zeo backbone (Addgene #61427) after BsmBI digestion. .. For expression of sgRNAs with a single MS2 hairpin integration, sgRNA sequences were synthesized as gBlocks (Integrated DNA technologies), and cloned into a Lenti_gRNA-Puro backbone (Addgene #84752) after BsmBI digestion.

Luciferase:

Negative Control:

Expressing:

Synthesized:

Recombinant:

Article Title: Single-cell profiling of lncRNAs in human germ cells and molecular analysis reveals transcriptional regulation of LNC1845 on LHX8
Article Snippet: Recombinant DNA reagent , Lenti-dCAS-VP64-Blast , Addgene , # 61425 , . .. Recombinant DNA reagent , Lenti-sgRNA(MS2)-zeo backbone , Addgene , # 61427 , . .. Recombinant DNA reagent , Lenti MS2-P65-HSF1_Hygro , Addgene , # 61426 , .

Review